Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 147247457 147272695 enh37161

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 147265841 rs146112790 A G 7866260
chr4 147265845 rs564934399 GATATCAAAAGAGATTTGATACACCAACAGTTTT G 7866261

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results