EnhancerDB
  1. Home
  2. TFBS
  3. ONECUT2[chr16:13206294-13206308]
Chromosome characteristics of ONECUT2[chr16:13206294-13206308]
Back to top
Enhancers possibly regulated by ONECUT2[chr16:13206294-13206308]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 13200045 13206674 enh31702
Liver (HepG2) Prostate (RWPE1) Astrocyte Thyroid Lung (PC-9) Muscle (Myoblast) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ONECUT2[chr16:13206294-13206308]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 13206300 rs138595507 TGGTTTTATGGAGCTTTACCAA T 4336375
chr16 13206300 rs374039262 TGGTTTTATGGAGCTTTACCAA T 4336376
Genes possibly regulated by ONECUT2[chr16:13206294-13206308]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ONECUT2[chr16:13206294-13206308]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results