Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 19245245 19259055 enh75761

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 19253315 rs527822923 A AGGGAAGTGAGGCAACAATAGGGT 4361363

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results