Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 19339179 19345370 enh31726

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 19343732 rs141284363 CCTTAAGCAATCTTCTCTCTTCAG C 4361773
chr16 19343732 rs368429315 CCTTAAGCAATCTTCTCTCTTCAG C 4361774

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results