Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20252825 20256975 enh69069

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20253389 rs562310276 CCTGTGTTAGGCAGTTAGG C 4365528
chr16 20253390 rs140156663 CTGTGTTAGGCAGTTAGGAGTGTGT C 4365529

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results