Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 10368193 10376645 enh23004

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 10371568 rs561227453 AATATGTGTATATTATATAT A 8823182

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results