Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 11726660 11734826 enh23030

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 11728144 rs528414078 GAAGAAGGAAGGAAGGAAGGAAGGACGGA G 8833183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results