EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr6:11728130-11728151]
Chromosome characteristics of ZNF263[chr6:11728130-11728151]
Back to top
Enhancers possibly regulated by ZNF263[chr6:11728130-11728151]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 11726660 11734826 enh23030
Large Intestine Blood (T-cell) Bone (Osteoblast) Blood (GM12878) Placenta Thyroid Muscle (Myotube) Thymus Stomach
SNP sites on ZNF263[chr6:11728130-11728151]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 11728144 rs528414078 GAAGAAGGAAGGAAGGAAGGAAGGACGGA G 8833183
chr6 11728146 rs60955508 AGAAG A 8833184
chr6 11728146 rs72405499 AGAAG A 8833185
chr6 11728146 rs773681735 AGAAG A 8833186
Genes possibly regulated by ZNF263[chr6:11728130-11728151]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr6:11728130-11728151]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results