EnhancerDB
  1. Home
  2. TFBS
  3. ETS2[chr6:11742219-11742224]
Chromosome characteristics of ETS2[chr6:11742219-11742224]
Back to top
Enhancers possibly regulated by ETS2[chr6:11742219-11742224]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 11740997 11747435 enh23031
Large Intestine Lung Stomach Placenta Pancreas Spleen Muscle (Myotube) Heart
chr6 11741947 11742326 vista50862
VISTA
SNP sites on ETS2[chr6:11742219-11742224]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 11742222 rs547267455 CCTTAGCTTTTCCCTATTTTGGTACCTACAATCA C 8833308
chr6 11742222 rs66753323 CCTTAGCTTTTCCCTATTTTGGTACCTACAATCA C 8833309
Genes possibly regulated by ETS2[chr6:11742219-11742224]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ETS2[chr6:11742219-11742224]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results