Enhancers that regulate MAP2K5[ENSG00000137764.15]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr15 67770205 67774355 enh75679 67835047 60692
chr15 67795265 67805457 enh3674 67835047 29590
chr15 67824765 67828915 enh87026 67835047 6132
chr15 67847385 67854233 enh3675 67835047 12338
chr15 67859500 67869635 enh3676 67835047 24453
chr15 67867550 67867820 vista20437 67835047 32503
chr15 67901825 67909795 enh52054 67835047 66778
chr15 67926783 67927143 vista20438 67835047 91736

Transcript facotrs that regulate MAP2K5[ENSG00000137764.15]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More

Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr15 66925589 rs67320356 AGAGTTT A 909458 Esophagus 0.11287 4038232
chr15 67835059 rs67999453 TCGCCGCTACCGCCGTCGCCGC T 0 Heart 6.84483e-06 4045767
chr15 67096658 rs7183242 A G 738389 Pancreas 0.221281 4040428
chr15 67835059 rs67999453 TCGCCGCTACCGCCGTCGCCGC T 0 Breast 6.41027e-10 4045767
chr15 67835059 rs67999453 TCGCCGCTACCGCCGTCGCCGC T 0 Ovary 9.60314e-05 4045767
chr15 67835059 rs67999453 TCGCCGCTACCGCCGTCGCCGC T 0 Thyroid 1.04852e-19 4045767
chr15 67298717 rs62007992 A C 536330 Liver 0.179799 4042709
chr15 67835059 rs67999453 TCGCCGCTACCGCCGTCGCCGC T 0 Lung 3.59171e-14 4045767
chr15 66913587 rs117008135 C A 921460 Stomach 0.321199 4038044
chr15 67468636 rs77100310 G C 366411 Adrenal 0.322832 4044614

Genomic Location chr15:67835047-68099461[+]
TSS 67835047
Gene Name MAP2K5
Ensembl ID ENSG00000137764.15
ENTREZID 5607
Uniprot
A0A024R5Y2
A0A024R5X5
Q13163
Protein Name
isoform CRA_a
isoform CRA_b
Dual specificity mitogen-activated protein kinase kinase 5
Dual-specificity mitogen-activated protein kinase kinase 5
Mitogen-activated protein kinase kinase 5
Mitogen-activated protein kinase kinase 5