EnhancerDB
  1. Home
  2. Gene
  3. BET1L[ENSG00000177951.13]
Enhancers that regulate BET1L[ENSG00000177951.13]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr11 253305 257455 enh111721 207428 45877
Brain (SK-N-MC)
chr11 264881 273232 enh1602 207428 57453
Bone Marrow (K562) Cervix (HeLa-S3) Lung Placenta Colon (HCT116) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Uterus Thymus
chr11 268826 269269 vista9299 207428 61398
VISTA
chr11 269337 269903 vista9300 207428 61909
VISTA
Transcript facotrs that regulate BET1L[ENSG00000177951.13]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with BET1L[ENSG00000177951.13], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr11 207359 rs11274545 C CGGCCACAGCCGCCTCAGACGT 0 Esophagus 4.97474e-13 1784661
chr11 334165 rs116521803 A G 126737 Esophagus 0.0847736 1785609
chr11 207275 rs6598075 C G 0 Thyroid 0.000285815 1784660
chr11 370303 rs75709474 C T 162875 Liver 0.063185 1786357
chr11 207693 rs373475006 CG C 265 Lung 0.021359 1784672
chr11 207359 rs11274545 C CGGCCACAGCCGCCTCAGACGT 0 Stomach 0.00268749 1784661
Details of BET1L[ENSG00000177951.13]
Back to top
Genomic Location chr11:167784-207428[-]
TSS 207428
Gene Name BET1L
Ensembl ID ENSG00000177951.13
ENTREZID 51272
Uniprot
A0A0C4DH16
Q9NYM9
Protein Name
BET1-like protein
Blocked early in transport 1 homolog
Expression levels of BET1L[ENSG00000177951.13]
Back to top