EnhancerDB

Enhancers that regulate PIGW[ENSG00000184886.3]

Back to top

Chrom.	Start	End	Enhancer ID	TSS of gene	Distance between enhancer and TSS	Tissues that enhancer appears	More
chr17	34817805	34821955	enh17120	34890847	68892	Placenta
chr17	34838937	34839070	vista24571	34890847	51777	VISTA
chr17	34871446	34871455	vista24572	34890847	19392	VISTA
chr17	34872097	34876938	enh60667	34890847	13909	Blood (OCI-LY7)
chr17	34875469	34875747	vista24573	34890847	15100	VISTA
chr17	34878505	34883255	enh58753	34890847	7592	Skin (Keratinocyte) Prostate (PC-3)
chr17	34904314	34908926	enh4372	34890847	13467	Blood (OCI-LY7) Blood (T-cell) Thymus Blood (Karpas-422)
chr17	34948982	34949076	vista24574	34890847	58135	VISTA
chr17	34963251	34970578	enh58754	34890847	72404	Bone Marrow (K562) Skin (Keratinocyte) Prostate (RWPE1) Esophagus Bone (Osteoblast)
chr17	34980705	34984855	enh88288	34890847	89858	Pancreas

Transcript facotrs that regulate PIGW[ENSG00000184886.3]

Back to top

Chrom.	Start	End	TF name	Source	Predicted site?	Tissue	TSS of gene	Distance between TFBS and gene	id	More

Chrom.	Position	dbSNP ID	Reference Allele	Alternative Allele	Distance between TSS and SNP	Tissue	q Value	id	More
chr17	34965349	rs1061121	T	C	70190	Esophagus	0.0883033	4848635
chr17	35760305	rs147127982	G	A	865146	Heart	0.218398	4852528
chr17	34891028	rs560299374	CTTGTGCGAGTGCGGCGGAGTG	C	0	Heart	0.0573337	4848421
chr17	34436532	rs1357365	G	A	454315	Pancreas	0.36786	4847434
chr17	35447871	rs1266181	C	A	552712	Spleen	0.446683	4851674
chr17	35088133	rs62071776	G	A	192974	Ovary	0.429015	4849293
chr17	34876195	rs11657469	T	A	14652	Thyroid	0.00736777	4848335
chr17	34901949	rs79010839	C	T	6790	Lung	0.0226564	4848464
chr17	34981013	rs8081726	T	C	85854	Stomach	0.28727	4848732

Genomic Location	chr17:34890847-34895159[+]
TSS	34890847
Gene Name	PIGW
Ensembl ID	ENSG00000184886.3
ENTREZID	284098
Uniprot
Uniprot	Q7Z7B1
Protein Name
	class W
	isoform CRA_a
	Phosphatidylinositol glycan
	Phosphatidylinositol-glycan biosynthesis class W protein