EnhancerDB
  1. Home
  2. Enhancers
  3. vista5264[chr1:223356140-223356312]
View enhancers around input chromosomal region
Back to top

Input Chromosomal region, for example: chr1:1000-10000 to view the enhancers around this region

Chromosome characteristics of vista5264[chr1:223356140-223356312]
Back to top
Tissue distribution of vista5264
Back to top
Transcription factor that possibly regulate vista5264[chr1:223356140-223356312]
Back to top
Chrom. Start End TF Name Source Predicted site? Tissue/Cell line id More
chr1 223356137 223356152 FOXP1 JASPAR yes 35646019
chr1 223356137 223356152 FOXP1 JASPAR yes 118466490
chr1 223356139 223356160 IRF1 JASPAR yes 35646020
chr1 223356139 223356160 IRF1 JASPAR yes 118466491
chr1 223356140 223356155 FOXP1 JASPAR yes 35646021
chr1 223356140 223356155 FOXP1 JASPAR yes 118466492
chr1 223356142 223356157 FOXP1 JASPAR yes 35646022
chr1 223356142 223356157 FOXP1 JASPAR yes 118466493
chr1 223356142 223356163 IRF1 JASPAR yes 35646023
chr1 223356142 223356163 IRF1 JASPAR yes 118466494
chr1 223356173 223356187 RORA JASPAR yes 35646024
chr1 223356173 223356187 RORA JASPAR yes 118466495
chr1 223356197 223356218 ZNF263 JASPAR yes 35646025
chr1 223356197 223356218 ZNF263 JASPAR yes 118466496
chr1 223356225 223356239 ONECUT1 JASPAR yes 35646026
chr1 223356225 223356239 ONECUT2 JASPAR yes 35646027
chr1 223356225 223356239 ONECUT3 JASPAR yes 35646028
chr1 223356225 223356239 ONECUT1 JASPAR yes 118466497
chr1 223356225 223356239 ONECUT2 JASPAR yes 118466498
chr1 223356225 223356239 ONECUT3 JASPAR yes 118466499
chr1 223356225 223356240 HNF1A JASPAR yes 35646029
chr1 223356225 223356240 HNF1A JASPAR yes 118466500
chr1 223356229 223356240 HOXC11 JASPAR yes 35646030
chr1 223356229 223356240 HOXD12 JASPAR yes 35646031
chr1 223356229 223356240 HOXC11 JASPAR yes 118466501
chr1 223356229 223356240 HOXD12 JASPAR yes 118466502
chr1 223356230 223356240 HOXC10 JASPAR yes 35646032
chr1 223356230 223356240 HOXD11 JASPAR yes 35646033
chr1 223356230 223356240 HOXC10 JASPAR yes 118466503
chr1 223356230 223356240 HOXD11 JASPAR yes 118466504
chr1 223356232 223356236 YY1 TRANSFAC yes 35646034
chr1 223356232 223356236 YY1 TRANSFAC yes 118466505
chr1 223356232 223356250 RARA JASPAR yes 35646035
chr1 223356232 223356250 RARA JASPAR yes 118466506
chr1 223356243 223356256 ZBTB18 JASPAR yes 35646036
chr1 223356243 223356256 ZBTB18 JASPAR yes 118466507
chr1 223356277 223356292 MAFK JASPAR yes 35646037
chr1 223356277 223356292 MAFK JASPAR yes 118466508
chr1 223356285 223356296 NFKB1 JASPAR yes 35646038
chr1 223356285 223356296 NFKB1 JASPAR yes 118466509
chr1 223356287 223356297 REL JASPAR yes 35646039
chr1 223356287 223356297 REL JASPAR yes 118466510
chr1 223356301 223356309 GATA3 JASPAR yes 35646040
chr1 223356301 223356309 GATA3 JASPAR yes 118466511
SNP sites on vista5264[chr1:223356140-223356312]
Back to top
chrom Position dbSNP ID Reference Allele Alternative Allele is SNP in TFBS id More
chr1 223356184 rs76194350 T C
RORA
975617
chr1 223356207 rs72743874 T C
ZNF263
975618
chr1 223356227 rs138768941 A AAAAATCATTATTTTTTAATGATTTTT
HNF1A ONECUT1 ONECUT2 ONECUT3
975619
Genes possibly regulated by vista5264[chr1:223356140-223356312]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance between enhancer and TSS id More
chr1 223282748 223316624 - TLR5 ENSG00000187554.7 223316624 0.86 1.0 1871 60484
Expression level of Genes
Back to top
miRNAs possibly regulated by vista5264[chr1:223356140-223356312]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand miRNA Name miRBase ID TSS Score TSI of Normal tissues TSI of Cancer tissues id More
Expression level of miRNAs
Back to top
No results