Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 223346429 223358855 enh12705
chr1 223356140 223356312 vista5264

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 223356227 rs138768941 A AAAAATCATTATTTTTTAATGATTTTT 975619

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results