EnhancerDB
  1. Home
  2. TFBS
  3. FOXC1[chr6:13352548-13352559]
Chromosome characteristics of FOXC1[chr6:13352548-13352559]
Back to top
Enhancers possibly regulated by FOXC1[chr6:13352548-13352559]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 13348613 13358032 enh8959
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Epithelial (MCF-7) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Lung (PC-9) Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Breast Thymus Heart
SNP sites on FOXC1[chr6:13352548-13352559]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 13352548 rs534636348 T A 8843239
chr6 13352549 rs512944 T A 8843240
chr6 13352559 rs566359640 T TACGTATATACGTGTATACATAGATAC 8843241
Genes possibly regulated by FOXC1[chr6:13352548-13352559]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXC1[chr6:13352548-13352559]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results