Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 18014566 18025616 enh38860

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 18024648 rs570804634 G GATGCTGCGTGTAGATATTCT 8880976

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results