EnhancerDB
  1. Home
  2. TFBS
  3. RXRG[chr6:29725837-29725851]
Chromosome characteristics of RXRG[chr6:29725837-29725851]
Back to top
Enhancers possibly regulated by RXRG[chr6:29725837-29725851]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 29723175 29734975 enh59606
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Blood (OCI-LY7) Muscle (A673) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Breast Neural Stem Cells (H9)
SNP sites on RXRG[chr6:29725837-29725851]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 29725840 rs10527081 GGCCAGAGGTTGCAGACCCTGGGAGTCAGCTGT G 8941182
chr6 29725840 rs67031264 GGCCAGAGGTTGCAGACCCTGGGAGTCAGCTGT G 8941183
Genes possibly regulated by RXRG[chr6:29725837-29725851]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RXRG[chr6:29725837-29725851]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results