Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 29725840 rs10527081 GGCCAGAGGTTGCAGACCCTGGGAGTCAGCTGT G 8941182
chr6 29725840 rs67031264 GGCCAGAGGTTGCAGACCCTGGGAGTCAGCTGT G 8941183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results