EnhancerDB
  1. Home
  2. TFBS
  3. NFYA[chr6:31061616-31061634]
Chromosome characteristics of NFYA[chr6:31061616-31061634]
Back to top
Enhancers possibly regulated by NFYA[chr6:31061616-31061634]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 31058575 31066735 enh49075
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Blood (T-cell) Colon (HCT116) Thyroid Neural Stem Cells (H9) Thymus Stomach
SNP sites on NFYA[chr6:31061616-31061634]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 31061625 rs186076782 A T 8952573
chr6 31061628 rs142482595 C CACT,CACTATTT,CACTATTTATTTATTT,CACTATTTATTTATTTATTT 8952574
Genes possibly regulated by NFYA[chr6:31061616-31061634]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFYA[chr6:31061616-31061634]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results