Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 32983845 32989555 enh9053
chr6 32986611 32987175 vista51624

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 32986895 rs183670337 G A,T 8970556
chr6 32986905 rs112089450 CTTTCACTTTCCCGTCTCATGCAAAG C 8970557

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results