Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 34348925 34358535 enh9066

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 34350344 rs570463333 AGGTCAAGGCAGGAGGGCTGCTGCTTC A 8980998

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results