EnhancerDB
  1. Home
  2. TFBS
  3. NR4A2[chr6:34350342-34350350]
Chromosome characteristics of NR4A2[chr6:34350342-34350350]
Back to top
Enhancers possibly regulated by NR4A2[chr6:34350342-34350350]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 34348925 34358535 enh9066
Liver (HepG2) Esophagus Liver Bone (Osteoblast) Blood (OCI-LY7) Muscle (A673) Thyroid Blood (Karpas-422) Pancreas (Panc1) Uterus Stomach
SNP sites on NR4A2[chr6:34350342-34350350]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 34350344 rs570463333 AGGTCAAGGCAGGAGGGCTGCTGCTTC A 8980998
Genes possibly regulated by NR4A2[chr6:34350342-34350350]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR4A2[chr6:34350342-34350350]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results