Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 41932119 rs113847211 A T 9028681
chr6 41932126 rs577856814 G A 9028682
chr6 41932132 rs555722905 ATGTGTGAATGTGTGTGTCTG A 9028683

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results