EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr16:27376975-27376996]
Chromosome characteristics of ZNF263[chr16:27376975-27376996]
Back to top
Enhancers possibly regulated by ZNF263[chr16:27376975-27376996]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27372645 27392475 enh16615
Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Uterus Thymus Epithelial (MCF-7)
SNP sites on ZNF263[chr16:27376975-27376996]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27376991 rs371048257 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395390
chr16 27376991 rs536606820 GGGGTATTTGTCCACCAGCTCCCATCTGTCATT G 4395391
Genes possibly regulated by ZNF263[chr16:27376975-27376996]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr16:27376975-27376996]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results