| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 27525082 | 27539775 | enh44273 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 27536506 | rs142571233 | T | TAAAAG,TAAAAGAAAAG,TAAAAGAAAAGAAAAG,TAAAAGAAAAGAAAAGAAAAG | 4396578 | |
| chr16 | 27536506 | rs184016129 | T | C,G | 4396579 | |
| chr16 | 27536506 | rs60325418 | T | TAAAAGAAAAG,TAAAAGAAAAGAAAAGAAAAG | 4396580 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|