Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29186971 29200375 enh64956

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29188031 rs562175451 C CCACCCGAGGGTCCCTGATGTGGGTCA 4402309

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results