Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 107535885 107547635 enh55923

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 107546130 rs531566895 T C 9239944
chr6 107546130 rs571068264 T TTGCAGTCATGCTGTTGGCCACGGC 9239945

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results