Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 107879965 107889695 enh9295

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 107880271 rs547815204 ATAAGTATTTGCTGAATGAAT A 9241763

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results