Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 111000785 111016695 enh23508

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 111015505 rs145878850 TATGCAAAAGGAAACTATGTTTCC T 9259151

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results