EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr6:112049630-112049634]
Chromosome characteristics of YY1[chr6:112049630-112049634]
Back to top
Enhancers possibly regulated by YY1[chr6:112049630-112049634]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 112040985 112061595 enh9322
Cervix (HeLa-S3) Brain (SK-N-MC) Blood (T-cell) Esophagus Astrocyte Blood (GM12878) Stomach Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Neural Stem Cells (H9) Thymus Heart
SNP sites on YY1[chr6:112049630-112049634]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 112049631 rs191576108 C G 9263818
chr6 112049632 rs150763249 ATTTCCATTATCTAATTCCAGAACAT A 9263819
chr6 112049632 rs367899491 ATTTCCATTATCTAATTCCAGAACAT A 9263820
Genes possibly regulated by YY1[chr6:112049630-112049634]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by YY1[chr6:112049630-112049634]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results