Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 112615445 112624375 enh23521

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 112617726 rs146046755 C CTTTGGTCTGAGCAATTAGAAGATGGAA 9267474

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results