| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 137306505 | 137313985 | enh72529 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 137312305 | rs11268140 | G | GTACATATTTATAAATATGAATATATAAAAATGTA | 9366702 | |
| chr6 | 137312305 | rs550010432 | G | GTACATATTTATAAATATGAATATATAAAAATGTA | 9366703 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|