| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 15266095 | rs61773638 | G | A | 100351 | |
| chr1 | 15266122 | rs370940082 | TTGGGACGTGCCTCTTGCATAGGGTGGAGTG | T | 100352 | |
| chr1 | 15266122 | rs573144608 | T | A | 100353 | |
| chr1 | 15266129 | rs542158731 | G | A,C | 100354 | |
| chr1 | 15266151 | rs72871867 | T | G | 100355 | |
| chr1 | 15266213 | rs940393 | C | T | 100356 | |
| chr1 | 15266572 | rs549293596 | G | A | 100357 | |
| chr1 | 15266591 | rs569104338 | T | C | 100358 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|