EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:16275606-16276116]
Chromosome characteristics of ZNF274[chr1:16275606-16276116]
Back to top
Enhancers possibly regulated by ZNF274[chr1:16275606-16276116]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 16272606 16295457 enh83
Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Blood (T-cell) Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Placenta Colon (HCT116) Adrenal Blood (Karpas-422) Muscle (Myoblast) Uterus Thymus Heart
chr1 16276028 16276482 vista505
VISTA
SNP sites on ZNF274[chr1:16275606-16276116]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 16275607 rs562881879 C T 108884
chr1 16275625 rs139183133 G T 108885
chr1 16275897 rs546301075 G A 108886
chr1 16275897 rs560056130 GGGCCCTCTTTTCTAGAAAGA G 108887
chr1 16276046 rs187272440 A C 108888
chr1 16276093 rs111821603 G A 108889
Genes possibly regulated by ZNF274[chr1:16275606-16276116]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:16275606-16276116]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results