EnhancerDB
  1. Home
  2. TFBS
  3. MYOD[chr1:31626685-31628650]
Chromosome characteristics of MYOD[chr1:31626685-31628650]
Back to top
Enhancers possibly regulated by MYOD[chr1:31626685-31628650]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 31622305 31630475 enh11709
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Placenta Uterus Epithelial (MCF-7)
chr1 31627566 31627958 vista1066
VISTA
chr1 31628220 31628457 vista1067
VISTA
SNP sites on MYOD[chr1:31626685-31628650]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 31626686 rs542721271 A C 209851
chr1 31626691 rs552912923 A C 209852
chr1 31626693 rs578045054 C CA 209853
chr1 31626695 rs143257054 G A 209854
chr1 31626712 rs12083894 T C 209855
chr1 31626776 rs11326762 CT C 209856
chr1 31626776 rs545424838 CT C 209857
chr1 31626804 rs66956635 TG T 209858
chr1 31626808 rs151324207 C G 209859
chr1 31626831 rs544414894 T A,C 209860
chr1 31626881 rs561064982 C T 209861
chr1 31626911 rs141909970 T C 209862
chr1 31626985 rs189153505 G A 209863
chr1 31627021 rs10914297 C T 209864
chr1 31627034 rs532114087 C T 209865
chr1 31627067 rs10914298 G T 209866
chr1 31627138 rs138446267 T C 209867
chr1 31627188 rs144008836 A G 209868
chr1 31627288 rs535952903 G T 209869
chr1 31627304 rs191240140 A G 209870
chr1 31627319 rs78380811 C G 209871
chr1 31627372 rs150316293 T C 209872
chr1 31627388 rs148864908 TTG T 209873
chr1 31627408 rs10914299 T A 209874
chr1 31627481 rs10914300 G A 209875
chr1 31627564 rs66460424 A C 209876
chr1 31627675 rs189320927 C G,T 209877
chr1 31627710 rs556333471 G T 209878
chr1 31627730 rs112681907 A C 209879
chr1 31627738 rs137996915 C T 209880
chr1 31627851 rs538757932 G A,T 209881
chr1 31627852 rs558869810 A G 209882
chr1 31627969 rs561353856 A ATCGGGC 209883
chr1 31627976 rs186000001 G T 209884
chr1 31628034 rs538112469 T G 209885
chr1 31628119 rs112756312 A T 209886
chr1 31628219 rs567738012 G A 209887
chr1 31628254 rs112172798 G A 209888
chr1 31628276 rs576826083 G T 209889
chr1 31628282 rs72889480 C A 209890
chr1 31628294 rs114228037 C T 209891
chr1 31628297 rs115197421 C T 209892
chr1 31628338 rs369533898 C T 209893
chr1 31628341 rs531812119 CG C 209894
chr1 31628365 rs549432472 CCCACCCGCTTTGGGCCGCGCT C 209895
chr1 31628386 rs116706538 T C 209896
chr1 31628485 rs6702899 A T 209897
chr1 31628547 rs6665500 G A 209898
chr1 31628551 rs116392752 A G 209899
Genes possibly regulated by MYOD[chr1:31626685-31628650]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYOD[chr1:31626685-31628650]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results