EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:94527306-94529143]
Chromosome characteristics of ZNF274[chr1:94527306-94529143]
Back to top
Enhancers possibly regulated by ZNF274[chr1:94527306-94529143]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 94525805 94540935 enh12065
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Esophagus Astrocyte Liver Lung Stomach Placenta Thyroid Lung (PC-9) Pancreas Uterus Thymus Heart
chr1 94527681 94527931 vista2525
VISTA
SNP sites on ZNF274[chr1:94527306-94529143]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 94527308 rs78527797 C T 492175
chr1 94527344 rs17110962 T C 492176
chr1 94527386 rs551648957 G A 492177
chr1 94527426 rs112535845 G A 492178
chr1 94527429 rs140319989 G C 492179
chr1 94527496 rs397980858 G GC 492180
chr1 94527496 rs4147889 G GC 492181
chr1 94527738 rs569254038 C A 492182
chr1 94527836 rs145632013 G A 492183
chr1 94527898 rs534106392 A C 492184
chr1 94527898 rs561968517 A AGCTACAACATCAACTCTTTTCCC 492185
chr1 94528011 rs574035594 C T 492186
chr1 94528018 rs185733427 C T 492187
chr1 94528138 rs117400594 G A 492188
chr1 94528142 rs61754024 A C 492189
chr1 94528143 rs61749417 C T 492190
chr1 94528192 rs61754023 C T 492191
chr1 94528346 rs61754021 C T 492192
chr1 94528359 rs61754022 C T 492193
chr1 94528363 rs4147833 C T 492194
chr1 94528373 rs116585401 C T 492195
chr1 94528387 rs145717494 G A,T 492196
chr1 94528499 rs17390419 A T 492197
chr1 94528543 rs542852588 C T 492198
chr1 94528646 rs61754020 C A,T 492199
chr1 94528699 rs547063913 C T 492200
chr1 94528729 rs74516571 C T 492201
chr1 94528774 rs145525174 C T 492202
chr1 94528775 rs61753963 C T 492203
chr1 94528814 rs201602424 G A 492204
chr1 94528818 rs61752395 C T 492205
chr1 94529071 rs116424413 A G 492206
Genes possibly regulated by ZNF274[chr1:94527306-94529143]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:94527306-94529143]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results