EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:94527663-94527939]
Chromosome characteristics of ZNF274[chr1:94527663-94527939]
Back to top
Enhancers possibly regulated by ZNF274[chr1:94527663-94527939]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 94525805 94540935 enh12065
Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Esophagus Astrocyte Liver Lung Stomach Placenta Thyroid Lung (PC-9) Pancreas Uterus Thymus Heart
chr1 94527681 94527931 vista2525
VISTA
SNP sites on ZNF274[chr1:94527663-94527939]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 94527738 rs569254038 C A 492182
chr1 94527836 rs145632013 G A 492183
chr1 94527898 rs534106392 A C 492184
chr1 94527898 rs561968517 A AGCTACAACATCAACTCTTTTCCC 492185
Genes possibly regulated by ZNF274[chr1:94527663-94527939]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:94527663-94527939]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results