EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:111759835-111760215]
Chromosome characteristics of ZZZ3[chr1:111759835-111760215]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:111759835-111760215]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 111752645 111768115 enh564
Skin (Keratinocyte) Liver (HepG2) Large Intestine Blood (T-cell) Esophagus Liver Blood (OCI-LY7) Blood (GM12878) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Breast Pancreas (Panc1) Thymus Stomach
chr1 111759901 111760085 vista2948
VISTA
SNP sites on ZZZ3[chr1:111759835-111760215]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 111759841 rs183103888 C G 557225
chr1 111759861 rs2820077 T C 557226
chr1 111759879 rs145986640 CTGCTAATAGAACCCCTATT C 557227
chr1 111760061 rs79811607 G A 557228
chr1 111760127 rs2820076 T C 557229
chr1 111760132 rs2764547 C T 557230
chr1 111760165 rs618216 C T 557231
Genes possibly regulated by ZZZ3[chr1:111759835-111760215]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:111759835-111760215]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results