Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182267181 182275215 enh12439
chr1 182269466 182269764 vista4139

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182269331 rs149468386 G T 773883
chr1 182269359 rs552149541 C T 773884
chr1 182269395 rs3001272 T C 773885
chr1 182269397 rs115894955 G A 773886
chr1 182269424 rs2985429 A G 773887
chr1 182269606 rs4509542 G T 773888
chr1 182269630 rs550008885 A AACCCCAAGAGGGTCTTACAGGAACCC 773889
chr1 182269678 rs2985430 T A 773890
chr1 182269701 rs2985431 C A 773891
chr1 182269763 rs2985432 T C 773892
chr1 182269777 rs3118151 C T 773893

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results