EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:205216756-205217286]
Chromosome characteristics of ZZZ3[chr1:205216756-205217286]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:205216756-205217286]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 205213505 205221135 enh12588
Brain (SK-N-SH) Ovary Stomach Placenta Pancreas Uterus Heart
chr1 205216742 205217034 vista4723
VISTA
SNP sites on ZZZ3[chr1:205216756-205217286]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 205216940 rs540759996 G GCAGCCCTGGCAGGGTTGAGTC 881463
chr1 205216971 rs138428576 C T 881464
chr1 205216972 rs370647985 G A 881465
chr1 205217094 rs552574904 C T 881466
chr1 205217103 rs11580253 G A 881467
chr1 205217244 rs12026002 A G 881468
Genes possibly regulated by ZZZ3[chr1:205216756-205217286]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:205216756-205217286]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results