Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 228911045 228922255 enh12749
chr1 228921739 228922035 vista5428

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 228921494 rs146463354 C T 1004344
chr1 228921636 rs12756030 C T 1004345
chr1 228921637 rs241312 G A,C,T 1004346
chr1 228921721 rs114342751 G A 1004347
chr1 228921781 rs73099572 C T 1004348
chr1 228921833 rs140890525 G A 1004349
chr1 228921863 rs149438461 G GACAGAAAACGGAAAGTGATGT 1004350

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results