| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 1803272 | rs573701465 | C | T | 1796425 | |
| chr11 | 1803353 | rs376977930 | G | C | 1796426 | |
| chr11 | 1803371 | rs144394902 | T | C | 1796427 | |
| chr11 | 1803494 | rs143916617 | TGCCCTGGACACAGCCCTAGTGGACAGAGG | T | 1796428 | |
| chr11 | 1803497 | rs12283924 | C | T | 1796429 | |
| chr11 | 1803512 | rs548796508 | A | C | 1796430 | |
| chr11 | 1803536 | rs2334409 | G | A,T | 1796431 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|