Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1788445 1806621 enh13684
chr11 1803283 1803679 vista9364

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1803494 rs143916617 TGCCCTGGACACAGCCCTAGTGGACAGAGG T 1796428
chr11 1803497 rs12283924 C T 1796429
chr11 1803512 rs548796508 A C 1796430
chr11 1803536 rs2334409 G A,T 1796431

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results