EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr11:2834838-2835433]
Chromosome characteristics of TCF7L2[chr11:2834838-2835433]
Back to top
Enhancers possibly regulated by TCF7L2[chr11:2834838-2835433]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2819305 2842289 enh13703
Cervix (HeLa-S3) Brain (SK-N-SH) Stomach Placenta Pancreas Muscle (Myotube) Uterus Thymus Heart
chr11 2834837 2835110 vista9432
VISTA
SNP sites on TCF7L2[chr11:2834838-2835433]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2834872 rs566595093 G A 1806451
chr11 2834896 rs234843 C T 1806452
chr11 2834916 rs142058796 G A 1806453
chr11 2835067 rs566171206 G A 1806454
chr11 2835071 rs75270583 G T 1806455
chr11 2835080 rs121256 C T 1806456
chr11 2835136 rs117267857 G C 1806457
chr11 2835229 rs3079053 A AATGG 1806458
chr11 2835229 rs3085884 A AATGG 1806459
chr11 2835229 rs34245273 A AATGG 1806460
chr11 2835229 rs569734377 A AATGG 1806461
chr11 2835229 rs571055830 AATGG A 1806462
chr11 2835417 rs566205275 G GGGGTAGATGGAGAGATGCATGAAT,GGGGTAGATGGAGAGATGCATGAATGGGTAGATGGAGAGATGCATGAAT 1806463
Genes possibly regulated by TCF7L2[chr11:2834838-2835433]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr11:2834838-2835433]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results