Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2819305 2842289 enh13703
chr11 2834837 2835110 vista9432

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2835067 rs566171206 G A 1806454
chr11 2835071 rs75270583 G T 1806455
chr11 2835080 rs121256 C T 1806456
chr11 2835136 rs117267857 G C 1806457
chr11 2835229 rs3079053 A AATGG 1806458
chr11 2835229 rs3085884 A AATGG 1806459
chr11 2835229 rs34245273 A AATGG 1806460
chr11 2835229 rs569734377 A AATGG 1806461
chr11 2835229 rs571055830 AATGG A 1806462
chr11 2835417 rs566205275 G GGGGTAGATGGAGAGATGCATGAAT,GGGGTAGATGGAGAGATGCATGAATGGGTAGATGGAGAGATGCATGAAT 1806463
chr11 2835451 rs554026679 T A 1806464
chr11 2835466 rs572156799 A G 1806465
chr11 2835467 rs536201717 G T 1806466
chr11 2835523 rs555058205 G A 1806467
chr11 2835529 rs576427529 A G,T 1806468
chr11 2835530 rs72844289 T C,G 1806469
chr11 2835648 rs73421333 G A 1806470
chr11 2835757 rs2237890 C T 1806471
chr11 2835780 rs123381 A G 1806472
chr11 2835869 rs565995593 G C 1806473
chr11 2836085 rs7480855 A G 1806474
chr11 2836213 rs234844 G C 1806475
chr11 2836283 rs138260726 A G 1806476
chr11 2836306 rs181603319 G A 1806477
chr11 2836477 rs560746420 G T 1806478

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results