Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3850985 3860835 enh1616
chr11 3859822 3860019 vista9465

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3859386 rs1349542 A G 1812056
chr11 3859427 rs547342468 C T 1812057
chr11 3859440 rs114657320 G T 1812058
chr11 3859496 rs563370698 G GC 1812059
chr11 3859609 rs74053503 G C 1812060
chr11 3859682 rs10835181 C T 1812061
chr11 3859712 rs142633216 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812062
chr11 3859712 rs75569785 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812063
chr11 3859856 rs10835182 T A 1812064
chr11 3859884 rs35591517 G GA 1812065
chr11 3859884 rs398044967 G GA 1812066
chr11 3860085 rs151107568 A G 1812067
chr11 3860087 rs546508749 T C 1812068

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 3848208 3862213 - RHOG ENSG00000177105.9 3862213 0.83 1.0 2093 10435


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results