EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:3859624-3860240]
Chromosome characteristics of ZNF274[chr11:3859624-3860240]
Back to top
Enhancers possibly regulated by ZNF274[chr11:3859624-3860240]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3850985 3860835 enh1616
Bone Marrow (K562) Large Intestine Esophagus Blood (OCI-LY7) Blood (GM12878) Stomach Blood (Karpas-422) Neural Stem Cells (H9) Heart
chr11 3859822 3860019 vista9465
VISTA
chr11 3860220 3860837 vista9466
VISTA
SNP sites on ZNF274[chr11:3859624-3860240]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3859682 rs10835181 C T 1812061
chr11 3859712 rs142633216 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812062
chr11 3859712 rs75569785 GAAAGTGCCTTGTATGCACATCCTTCTCTA G 1812063
chr11 3859856 rs10835182 T A 1812064
chr11 3859884 rs35591517 G GA 1812065
chr11 3859884 rs398044967 G GA 1812066
chr11 3860085 rs151107568 A G 1812067
chr11 3860087 rs546508749 T C 1812068
chr11 3860221 rs543250850 T A 1812069
chr11 3860231 rs189715331 C T 1812070
Genes possibly regulated by ZNF274[chr11:3859624-3860240]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 3848208 3862213 - RHOG ENSG00000177105.9 3862213 0.83 1.0 1973 10435
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr11:3859624-3860240]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results