EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr11:9556247-9556863]
Chromosome characteristics of ZNF143[chr11:9556247-9556863]
Back to top
Enhancers possibly regulated by ZNF143[chr11:9556247-9556863]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 9547085 9559092 enh1629
Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Muscle (A673) Placenta Pancreas (Panc1) Blood (Karpas-422) Lung (PC-9) Muscle (Myoblast) Spleen Neural Stem Cells (H9) Stomach
chr11 9556408 9556424 vista9569
VISTA
SNP sites on ZNF143[chr11:9556247-9556863]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 9556410 rs575538986 TA T 1834377
chr11 9556513 rs574072349 T TGAGGGCCCTAGGAGCACAG 1834378
chr11 9556518 rs369190274 G GC 1834379
chr11 9556518 rs532260924 G GC 1834380
chr11 9556539 rs557730412 C A 1834381
chr11 9556743 rs76787617 C A,G,T 1834382
chr11 9556795 rs55709406 G A 1834383
chr11 9556800 rs79925991 A G 1834384
chr11 9556818 rs4910474 C G 1834385
Genes possibly regulated by ZNF143[chr11:9556247-9556863]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr11:9556247-9556863]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results