Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 68147881 rs555044440 G A 2065338
chr11 68147936 rs576490391 C T 2065339
chr11 68148077 rs58373012 G A 2065340
chr11 68148131 rs541777751 CGCAGTGGGGCGTGTCCTGCAT C 2065341
chr11 68148152 rs569258151 T C 2065342
chr11 68148199 rs638642 T C 2065343

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results