EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr11:68147797-68148233]
Chromosome characteristics of ZBTB33[chr11:68147797-68148233]
Back to top
Enhancers possibly regulated by ZBTB33[chr11:68147797-68148233]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 68134683 68153777 enh1858
Brain (SK-N-MC) Liver Astrocyte Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Kidney Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr11 68147876 68148306 vista10712
VISTA
SNP sites on ZBTB33[chr11:68147797-68148233]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 68147881 rs555044440 G A 2065338
chr11 68147936 rs576490391 C T 2065339
chr11 68148077 rs58373012 G A 2065340
chr11 68148131 rs541777751 CGCAGTGGGGCGTGTCCTGCAT C 2065341
chr11 68148152 rs569258151 T C 2065342
chr11 68148199 rs638642 T C 2065343
chr11 68148222 rs80060126 C T 2065344
Genes possibly regulated by ZBTB33[chr11:68147797-68148233]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr11:68147797-68148233]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results