EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr11:125980178-125980414]
Chromosome characteristics of ZZZ3[chr11:125980178-125980414]
Back to top
Enhancers possibly regulated by ZZZ3[chr11:125980178-125980414]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 125968850 126000095 enh2086
Adrenal Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673) Heart
chr11 125980178 125980467 vista11996
VISTA
SNP sites on ZZZ3[chr11:125980178-125980414]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 125980308 rs138296123 G A 2343729
chr11 125980310 rs557138385 T TCATTCTGGGTAACAGAGCC 2343730
chr11 125980351 rs561119079 C G,T 2343731
chr11 125980368 rs147168156 T C 2343732
chr11 125980375 rs543932 A C 2343733
chr11 125980382 rs115620377 G A 2343734
chr11 125980386 rs192752978 C T 2343735
Genes possibly regulated by ZZZ3[chr11:125980178-125980414]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr11:125980178-125980414]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results